Haplogroup I1 (Y-DNA)


Haplogroup I1 (Y-DNA)

Infobox haplogroup
name =I1


origin-date =4,000 to 20,000 BC
origin-place =Balkans, Scandinavia, France, Iberia or Ukraine
ancestor = I
descendants =
mutations =M253, M307, P30, P40
members =People of Northern Europe (Norwegian, Swedish, English, Danish, Saami, Finnish, Welsh, German, Scottish, Irish)
In human genetics, Haplogroup I1 is a Y-chromosome haplogroup occurring at greatest frequency in Scandinavia, associated with the mutations identified as M253, M307, P30, and P40. These are known as single nucleotide polymorphisms (SNPs). It is a subclade of Haplogroup I. Before a reclassification in 2008, [Tatiana M. Karafet "et al", [http://www.genome.org/cgi/content/abstract/gr.7172008v1 New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree] , "Genome Research", doi|10.1101/gr.7172008 (2008)] the group was known as Haplogroup I1a. [ [http://archiver.rootsweb.ancestry.com/th/read/Y-DNA-HAPLOGROUP-I/2008-04/1209430337 Clade I Information from 2008 Research Paper (Karafet "et al")] ] Many individuals and organizations continue to use the I1a designation.

The group displays a very clear frequency gradient, with a peak of approximately 40 percent among the populations of western Finland and more than 50 percent in the province of Satakunta, [ [http://www.blackwell-synergy.com/doi/abs/10.1111/j.1469-1809.2007.00429.x Annals of Human Genetics. Volume 72 Issue 3 Page 337-348, May 2008] ] around 35 percent in southern Norway, southwestern Sweden especially on the island of Gotland, and Denmark, with rapidly decreasing frequencies toward the edges of the historically Germanic sphere of influence. [ [http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1a_large_RG.jpgMap of I1a] ]

Origins

For several years the prevailing theory was that during the Last Glacial Maximum (LGM) [ [http://paleoshaman.com/introduc.htm Introduction to the Ice Age] ] the I1 group sought refuge in the Balkans. [ [http://dsa.duncanroots.com/Clan_News/DNAreport2006.01_files/image002.jpgMap of LGM Haplogroup Refuges] ] For a time, the Ukraine was considered as an alternative. Yet, The Genographic Project claims that the founder of the I1 branch lived on the Iberian Peninsula during the LGM. Some have given southern France and the Italian peninsula as possible sites as well. [ [http://www.protobulgarians.com/Statii%20ot%20drugi%20avtori/Genome-1.gifMaps of Haplogroup I Subclades] ] Although the locations vary, proponents of the refuge theories do seem to agree on one issue: that the I1 subclade is from 15,000 to 20,000 years old. [ [http://www3.nationalgeographic.com/genographic/atlas.html Atlas of the Human Journey] ]

[


thumb|left|300px|Approximately_20,000_years_ago,_much_of_Europe_was_covered_in_ice_and_permafrost._People_in_Europe_were_forced_south_by_the_changing_climate_and_topography._The_European_LGM_refuges_included_the_Iberian_penninsula_and_the_Balkans,_where_some_believe_the_ancestors_of_I1_lived._The_theory_has_been_challenged_recently_by_an_opposing_argument_that_I1_was_not_in_existence_during_the_LGM._Two_primary_cultures_have_been_identified_during_this_time:_the_Solutrean (Iberia and southern France) and the Gravettian (Balkans, Italy and Ukraine).]

However, professor Ken Nordtvedt of Montana State University believes that I1 is a more recent group, probably emerging "after" the LGM. [ [http://archiver.rootsweb.com/th/read/Y-DNA-HAPLOGROUP-I/2007-12/1198467954 RootsWeb: Discussion on Y-DNA-HAPLOGROUP-I Mailing List] ] Other researchers including Peter A. Underhill of the [http://hpgl.stanford.edu Human Population Genetics Laboratory] at Stanford University have since confirmed this hypothesis in independent research. [ [http://www.smgf.org/publications.jspx New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory] ] [ [http://archiver.rootsweb.com/th/read/Y-DNA-HAPLOGROUP-I/2008-03/1205856226 Nordtvedt Overview of New Phylogenetic Relationships for Y-chromosome Haplogroup I] ]

The study of I1, which some had argued was largely ignored by the genetic testing industry in favor of "mega-haplogroups" like R, is in flux. Revisions and updates to previous thinking, primarily published in academic journals, is constant, yet slow, showing an evolution in thought and scientific evidence. [ [http://encarta.msn.com/encyclopedia_761561500/Vikings.html#s5 No Consensus on Viking Influence] ]

The most recent common ancestor (MRCA) of I1 lived from 4,000 to 6,000 years ago somewhere in the far northern part of Europe, perhaps Denmark, according to Nordtvedt. His descendants are primarily found among the Germanic populations of northern Europe and the bordering Uralic and Celtic populations, although even in traditionally German demographics I1 is overshadowed by the more prevalent Haplogroup R.

When SNPs are unknown or untested and when short tandem repeat (STR) results show eight allele repeats at DNA Y-chromosome Segment (DYS) 455, haplogroup I1 can be predicted correctly with a very high rate of accuracy, 99.3 to 99.8 percent, according to Whit Athey and Vince Vizachero. [ [http://home.comcast.net/~hapest5/ Y-Haplogroup Predictor] ] [ [http://www.vizachero.com/I1aFreqTable.pdf Allele Frequency Among I1a Samples] ] This is nearly exclusive and ubiquitous to the I1 haplogroup, with very few having seven, nine or otherwise. Furthermore, DYS 462 divides I1 geographically. Nordtvedt considers 12 allele repeats to be more likely Anglo-Saxon and on the southern fringes of the I1 map while 13 signifies more northernly, Nordic origins. [ [http://archiver.rootsweb.com/th/read/y-dna-haplogroup-i/2007-04/1176386234 Signature Markers] ] SNP testing is generally not as beneficial as expanded STR results, Nordtvedt has repeatedly argued, at least for I1.

Subclades

Note: the systematic subclade names have changed several times in recent years, and are likely to change again, as new markers are discovered which clarify the sequence of branching of the tree.

*I1 (M253, [ [http://www.snp-y.org/files/e1213b6469cf231a3fa9237332d90e095b2468f6.cinnioglu2004.pdf Excavating Y-chromosome haplotype strata in Anatolia] ] M307, [ [http://www.snp-y.org/files/b735576a3e40b3379993b7b840af4f877c0738e2.shen2004.pdf Reconstruction of Patrilineages and Matrilineages of Samaritans and Other Israeli Populations From Y-Chromosome and Mitochondrial DNA Sequence Variation] ] M450, P30, P40, S62, S63, S64, S65, S66, S107, S108, S109, S110, S111 [ [http://www.isogg.org/tree/ISOGG_HapgrpI08.html Y-DNA Haplogroup I and its Subclades - 2008] ] ) "formerly I1a"
**I1*
**I1a (M21) "formerly I1a2"
**I1b (M227) "formerly I1a1, I1a4"
***I1b*
***I1b1 (M72) "formerly I1a1a, I1a3"
**I1c (P109)
**I1d (P259)

Distribution

Outside Scandinavia, distribution of Haplogroup I1 is closely correlated with Haplogroup I2a1, but among Scandinavians including both Germanic and Uralic peoples of the region nearly all the Haplogroup I chromosomes are I1. I1 is common in men living near the southern Baltic and North Sea coasts, although successively decreasing the further south one goes.

Britain

The traditional view of British and Irish prehistory was that several waves of migration and population displacement had occurred. The region was repopulated after the Last Glacial Maximum, by paleolithic hunter gatherers. During the neolithic with the spread of farming this population was supposed to have been replaced by farmers. Later putative immigrations were thought to have accompanied the transitions to bronze working (Bronze Age) and iron working (Iron Age). The transition to iron working was particularly significant because it was fixed in the minds of past archaeologists with specific material cultures associated with the Hallstatt and La Tène cultures. These cultures came to be associated by early archaeologists with a putative pan-European Celtic culture. A later invasion was also claimed to have led to wholescale population replacement, that of the Anglo-Saxons. Other population movements (though not wholescale displacements) recorded during historical times include those of the Danish and Norwegian Vikings, Danes in the east of England (especially the Danelaw) and Norwegians in the Shetland and Orkney Isles, Western Isles and Ireland.

This traditional view has come under sustained attack since the 1960s, with British and Irish archaeologists claiming a much greater continuity than previously. Simon James puts the original view of large scale mass migration down to the assumptions of primitivism about earlier inhabitants of the region. Modern archaeologists recognise that cultural changes amongst indigenous populations can be dramatic and can occur very rapidly, therefore many of these transitions, that of hunter gathering to farming, stoneworking to metalworking, bronze working to iron working, need not be the result of population movements at all, but the product of the new techniques being learned by the indigenous population. Archaeologist Francis Pryor has stated that he "can't see any evidence for "bona fide" mass migrations after the Neolithic." ["Britain BC: Life in Britain and Ireland before the Romans" by Francis Pryor, p. 122. Harper Perennial. ISBN 0-00-712693-X.] Historian Malcolm Todd writes "It is much more likely that a large proportion of the British population remained in place and was progressively dominated by a Germanic aristocracy, in some cases marrying into it and leaving Celtic names in the, admittedly very dubious, early lists of Anglo-Saxon dynasties. But how we identify the surviving Britons in areas of predominantly Anglo-Saxon settlement, either archaeologically or linguistically, is still one of the deepest problems of early English history." [" [http://www.intellectbooks.com/nation/html/anglos.htm Anglo-Saxon Origins: The Reality of the Myth] " by Malcolm Todd. Retrieved 1 October 2006.] Although the idea of mass human migrations into Great Britain and Ireland is now a relatively minor point of view amongst British and Irish archaeologists, there is still a perception outside of the archaeological community that especially an "Anglo-Saxon" mass migration occurred, and that this forms a fundamental division between English "Anglo-Saxon" populations in Great Britain and non-English "Celtic" populations.

In 2002 a paper entitled "Y chromosome Evidence for Anglo-Saxon Mass Migration" [ [http://mbe.oxfordjournals.org/cgi/content/full/19/7/1008 Y chromosome Evidence for Anglo-Saxon Mass Migration] " (2002) Michael E. Weale, Deborah A. Weiss, Rolf F. Jager, Neil Bradman and Mark G. Thomas. "Molecular Biology and Evolution" 19:1008-1021] which claimed to have direct genetic evidence for population differences between the English and Welsh populations, and proposed a model for mass invasion of eastern Great Britain from northern Germany. This paper assumed that populations with large proportions of haplogroup I originated from northern Germany or southern Scandinavia (particularly Denmark) and that their ancestors had migrated across the North Sea with either "Anglo-Saxon" migrations or with Danish Vikings. The archaeologist Catherine Hills discusses this conclusion in her book "The Origins of the English" and criticises it's conclusions, claiming that this result may be due to a biased sampling strategy, especially the sampling of only regions in England where it is known that Danes settled during the period of the Danelaw, and which is archaeologically distinct. The main claim by Weal "et al." (2002) is that

we estimate that an Anglo-Saxon immigration event affecting 50%–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number....This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea....These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
These conclusions were reported inaccurately in the UK media, with the BBC claiming that the "English and Welsh are races apart" [" [http://news.bbc.co.uk/1/hi/wales/2076470.stm English and Welsh are races apart] " BBC News. June 2002] with the assertion that "It suggests that between 50% and 100% of the indigenous population of what was to become England was wiped out", a claim not made by the Weal "et al." paper. The conclusion for evidence of mass Anglo-Saxon migration, and that east English samples were more similar to Frisian samples than to Welsh samples, did not support the archaeological orthodoxy of modern times. A year later, in 2003, the paper "A Y Chromosome Census of the British Isles" was published by Capelli "et al.". [" [http://www.ucl.ac.uk/tcga/tcgapdf/capelli-CB-03.pdf A Y Chromosome Census of the British Isles] " (2003) Cristian Capelli, Nicola Redhead, Julia K. Abernethy, Fiona Gratrix, James F. Wilson, Torolf Moen, Tor Hervig, Martin Richards, Michael P.H. Stumpf, Peter A. Underhill, Paul Bradshaw, Alom Shaha, Mark G. Thomas, Neal Bradman, and David B. Goldstein "Current Biology" Vol 13, 979-984 doi|10.1016/S0960-9822(03)00373-7] This paper, which sampled Great Britain and Ireland on a grid, found a much smaller difference between Welsh and English samples, and was much more characterised by isolation by distance, with a gradual decrease in Haplogroup I frequency moving westwards in southern Great Britain. It also found North German and Danish samples were not more similar to east English samples than than Welsh samples.

Oxford archaeologist David Miles has argued that 80 percent of the genetic makeup of native Britons probably comes from "just a few thousand" nomadic tribesmen who arrived 12,000 years ago, at the end of the Ice Age. This suggests later waves of immigration may have been too small to have significantly affected the genetics of the pre-existing population. [ [http://news.nationalgeographic.com/news/2005/07/0719_050719_britishgene.html British Have Changed Little Since Ice Age, Gene Study Says] ]

Traditionally, areas with a majority Angle influence included the Kingdoms of "Nord Angelnen" (Northumbria), "Ost Angelnen" (East Anglia) and "Mittlere Angelnen" (Mercia) while the Saxon areas were the Kingdoms of Sussex, Essex, and Wessex. [ "Ecclesiastical History of the English People"] The Kingdom of Kent was considered a place of another Germanic tribe, the Jutes. Oppenheimer suggested that the Anglo-Saxon invasions actually had been predominantly Anglian. [ "The Origins of the British" by Stephen Oppenheimer]

Meanwhile, Sykes said that the Anglo-Saxons made a substantial contribution to the genetic makeup of England, but probably less than 20 percent of the total, even in southern England, where raids and settlements were supposedly commonplace. His conclusions, on Britain at least, mirror those of other researchers including Rootsi and Nordtvedt. [ [http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2004-05/1085795958 Summarization of Rootsi Paper by Nordtvedt] ] A report on the Saxons who were part of the Germanic settlement of Britain during and after the 5th century was issued by University College London in July 2006, with a wide ranging estimate for the total number of settlers varying between 10,000-200,000. [ [http://www.ucl.ac.uk/media/library/apartheidengland/ Germans set up an apartheid-like society in Britain] ]

The Vikings, both Danes and Norwegians, also made a substantial contribution after the Angles, Saxons and Jutes, Sykes said, with concentrations in central, northern, and eastern England, territories of the ancient Danelaw. Sykes said he found evidence of a very heavy Viking contribution in the Orkney and Shetland Islands, near 40 percent. Mitochondrial DNA as well as Y DNA of northern Germanic origin were discovered at substantial rates in all of these areas, showing that the Vikings engaged in large-scale settlement, Sykes explained. However, Nordtvedt has said that separating I1 haplotypes into Viking and non-Viking groups has been impossible thus far.

Genetic evidence of Norman influence in England was extremely small, about two percent according to Sykes, discounting the idea that William the Conqueror, his troops and any settlers disrupted and displaced previous cultures. Some notable British historians and Anglophiles including J. R. R. Tolkien assumed that the Norman invasion of AD 1066 greatly affected the society of the time and that little survived from the "original" Britons. This worldview permeates Tolkien's "The Lord of the Rings" and other writings, though he focuses on Germanic folktales and legends rather than the Celtic in creating a replacement mythology, albeit fictional. In England from the 5th to 7th centuries the Anglo-Saxons soon developed their own variety as well.

The study of languages and place names provides more supporting evidence. For example, Old English emerged from the Anglo-Frisian dialects brought to Britain by Germanic settlers and perhaps Roman soldiers. The convergence of varying languages lends credence to a diverse genetic pool. Initially, the English language began as a diverse group of dialects reflecting the varied backgrounds of the Anglo-Saxon kingdoms. One of these dialects, Late West Saxon, eventually dominated.

Then two waves of invaders brought new influences. The first was by language speakers of the Scandinavian branch, known as North Germanic. They conquered and colonized parts of Britain in the 8th and 9th centuries. The second was the Normans in the 11th century, who spoke Old French and ultimately developed an English variety called Anglo-Norman. These two invasions caused English to become linguistically "mixed" to some degree. English developed into a "borrowing" language of great flexibility with a large vocabulary.

In England the Viking Age began dramatically on June 8, 793 when Norsemen destroyed the abbey at Lindisfarne, plundering and murdering indiscriminately. An incident four years earlier where three Viking ships were beached in Portland Bay, perhaps on a trading expedition, created some tension, but Lindisfarne was different. The devastation of Northumbria's Holy Island shocked many including the royal Courts of Europe. More than any other single event, the attack on Lindisfarne cast a shadow on the perception of the Vikings for the next twelve centuries.

France

Genetic remnants remain in northern France, indicating a small influx of I1 men, likely during Viking raids and subsequent settlement. [ [http://www.ysearch.org/haplosearch_results.asp?uid=&haplo=I1a&region=WE&submit=Search I1a Samples in Western Europe from ySearch] ] Subtle increases in I1 haplotypes indicate a modest contribution, perhaps from a combination of the Frankish migration during the last days of the Roman Empire and later Viking incursions. Nordtvedt subscribes to this concept. [ [http://archiver.rootsweb.com/th/read/GENEALOGY-DNA/2004-05/1085795958 Nordtvedt on I1a, Northern France and the Vikings] ]

The Franks, from whom France is named and literally meaning "Land of the Franks," were a Germanic tribe first identified in the 3rd century as an ethnic group living north and east of the Lower Rhine. They founded one of the Germanic monarchies which replaced the Western Roman Empire from the 5th century. The Frankish state consolidated its hold over large parts of western Europe by the end of the 8th century. The Carolingian Empire and its successor states were Frankish.

Following the successful example of a Cornish-Viking alliance in 722 at the Battle of Hehil, which helped stop the Anglo-Saxon conquest of Cornwall at the time, the people of Brittany (Bretons) made friendly overtures to the Danish Vikings in an effort to counter Frankish expansionism. In 866 the Vikings and Bretons united to defeat a Frankish army at the Battle of Brissarthe, resulting in formal recognition of Brittany's independence.

The Vikings continued to tactically help their Breton allies by devastating Frankish areas under the Carolingians with pillaging raids. In 885, one of the minor Viking leaders named Rollo helped in the siege of Paris under the command of Danish king Sigfred. When Sigfred retreated in return for tribute the following year, Rollo stayed behind and was eventually bought off and sent to bother Burgundy by the Frankish king, Charles the Simple. Later, he returned to the Seine with a group of Danish followers who were called "Men of the North" or Norsemen. They invaded the area of northern France now known as Normandy.

Rather than pay Rollo to leave, as was customary, Charles the Simple realized that his armies could not effectively defend against the raids and guerrilla tactics, and decided to appease Rollo by giving him land and hereditary titles under the condition that he defend against other Vikings. Led by Rollo, the Vikings settled in Normandy after being granted the land. They subsequently established the Duchy of Normandy. The descendants who emerged from the interactions between Vikings, Franks and Gallo-Romans became known as Normans. This may explain why a noticeably higher than average rate of men living in northernwestern France today are I1. [ [http://upload.wikimedia.org/wikipedia/commons/e/e5/Normannen.pngTerritory with Norman Influence] ]

The Scandinavian colonisation of Normandy was principally Danish, complemented by a strong Norwegian contingent, although a few Swedes were present. The Viking colonization was not a mass phenomenon. However, they established themselves rather densely in some areas, particularly Pays de Caux and the northern part of the Cotentin. Toponymic and linguistic evidence supports this theory. The merging of the Scandinavian and native populations contributed to the creation of one of the most powerful feudal states of Western Europe. The naval ability of the Normans would allow them to conquer England, and participate in the Crusades.

candinavia

Russia

In Russia Scandinavian invaders in the 9th and 10th centuries were known as Varangians. [ [http://www.encyclopedia.com/doc/1E1-Vikings.html Viking Description from The Columbia Encyclopedia, Sixth Edition] ] They were primarily Swedish. The Varangians have been described as a warrior elite or nobility.

Varangian leader Rurik is credited with founding the first Russian state. Although recent genetic studies have identified two major royal lines within Russian society, R1a and N1c1a, [ [http://www.familytreedna.com/public/rurikid/index.aspx?fixed_columns=on Vikings in Russia, Rurikid Dynasty DNA Project] ] genetic research shows significant I1 contribution centering on Moscow. [ [http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1a_large_RG.jpgMap of I1a in Russia] ]

John Haywood, author of "The Great Migrations", believes that a group known as the Rus preceded the Varangians. However, most identify the Rus people as a particular Varangian tribe. A large burial mound in Novgorod Oblast, Russia, known as a tumulus, dating from the 9th century is similar to those found in Old Uppsala, Sweden. It is reportedly well-defended against potential looters and has never been excavated. Local residents refer to it as 'Rurik's Grave'.

Scandinavians remained in control of areas such as Kiev until at least the mid-11th century. [Michael Psellus: "Chronographia", ed. E. Sewter, (Yale University Press, 1953), 91. and R. Jenkins, "Byzantium: The Imperial Centuries AD 610-1071" (Toronto 1987) p. 307] They became the nucleus of the Rus' state, whose Golden Age in the 11th and early 12th centuries came to an abrupt end with the Mongol invasion of 1240.

Their campaigns are commemorated on many runestones in Sweden, such as the Greece Runestones and the Varangian Runestones. The last major expedition appears to have been the ill-fated expedition of Ingvar the Far-Travelled to Serkland, a region southeast of the Caspian Sea, commemorated by the Ingvar Runestones. What happened to the men is not known.

Greece & Turkey

Another branch of Varangians dominated the Byzantine Empire military elite for a time. This could be the precursor of spikes in I1 haplotypes in Turkey and Greece near Istanbul. A military unit known as the Varangian Guard was established by Emperor Basil II. After Rus' military recruits helped him quell a rebellion, Basil II formed an alliance with Vladimir I of Kiev and organized the guard. New recruits from Sweden, Denmark, and Norway continued the Scandinavian predominance of the guard until the late 11th century. So many Swedes left to enlist in the guard that a medieval Swedish law stated that no man could gain his inheritance while remaining in Greece. [Jansson 1980:22] In "The History of the Crusades" author Steve Runciman noted that by the time of the Emperor Alexius, the Byzantine Varangian Guard was largely recruited from Anglo-Saxons in England and "others who had suffered at the hands" of the Vikings and the Normans.

Haplotypes

Modal

Nordtvedt has given the following 'modal haplotypes' within the I1 haplogroup according to examples found in I1 populations. [ [http://dgmweb.net/genealogy/DNA/Hg-I-subclades-FTDNA-order.shtml Y-DNA Haplogroup I Modal Haplotypes - with Markers in FTDNA Order ] ] Many I1-Norse types (since the reorganization of the human Y-chromosome phylogenetic tree) have been found to be downstream of the P109 SNP, concretely defining it as a haplogroup subclade & giving further credence to Nordtvedt's method of haplotyping. [ [http://archiver.rootsweb.ancestry.com/th/read/Y-DNA-HAPLOGROUP-I/2008-04/1209560622 I1a and P109] & [http://archiver.rootsweb.ancestry.com/th/read/Y-DNA-HAPLOGROUP-I/2008-04/1209566777 P109 as Individual I1a SNP] ]

Such haplotyping is necessary because there currently exists more resolution of potential subclades through matching STR alleles than is available via testing for known subclade SNPs in haplogroup I1.

I1 Anglo-Saxon (I1-AS) "Has its peak gradient in the Germanic lowland countries: north Germany, Denmark, the Netherlands, as well as the British Isles & old Norman regions of France."DYS
393 = 13
390 = 22
394 = 14
391 = 10
385a = 13
385b = 14
426 = 11
388 = 14
439 = 11
389i = 12
392 = 11
389ii = 28
458 = 15
459a = 8
459b = 9
455 = 8
454 = 11
447 = 23
437 = 16
448 = 20
449 = 28
DYS
464a = 12
464b = 14
464c = 15
464d = 16
460 = 10
GATA-H4 = 12
YCAIIa = 19
YCAIIb = 21
456 = 14
607 = 14
576 = —
570 = —
CDYa = —
CDYb = —
442 = 12
438 = 10
531 = 11
578 = 8
395S1a = 15
395S1b = 15
590 = 8
537 = 11
641 = 10
472 = 8
406S1 = 9
511 = 9
425 = 12
413a = 23
413b = 25
557 = 15
594 = 10
436 = 12
490 = 12
534 = 15-17
450 = 8
444 = 13
481 = 25
520 = 20
446 = 13
617 = 13
568 = 11
487 = 12
572 = 11
640 = 11
492 = 12
565 = 11
461 = 12
462 = 12
GATA-A10 = 13
635/C4 = 21;22
B07 = 11
441 = 16
445 = 11
452 = 12
463 = 19

I1 Norse (I1-N) "Has its peak gradient in Sweden."DYS
393 = 13
390 = 23
394 = 14
391 = 10
385a = 14
385b = 14
426 = 11
388 = 14
439 = 11
389i = 12
392 = 11
389ii = 28
458 = 15
459a = 8
459b = 9
455 = 8
454 = 11
447 = 23
437 = 16
448 = 20
449 = 28
DYS
464a = 12
464b = 14
464c = 15
464d = 16
460 = 10
GATA-H4 = 12
YCAIIa = 19
YCAIIb = 21
456 = 14
607 = 14
576 = —
570 = —
CDYa = —
CDYb = —
442 = 12
438 = 10
531 = 11
578 = 8
395S1a = 15
395S1b = 15
590 = 8
537 = 11
641 = 10
472 = 8
406S1 = 9
511 = 10
425 = 12
413a = 23
413b = 25
557 = 15
594 = 10
436 = 12
490 = 12
534 = 16
450 = 8
444 = 13
481 = 25
520 = 20
446 = 13
617 = 13
568 = 11
487 = 12
572 = 11
640 = 11
492 = 12
565 = 11
461 = 12
462 = 13
GATA-A10 = 13
635/C4 = 21;22
B07 = 11
441 = 16
445 = 11
452 = 12
463 = 19

I1 Norse-Bothnia (I1-N-Finn) "Has its peak gradient in Finland."DYS
393 = 13
390 = 23
394 = 14
391 = 10
385a = 14
385b = 14
426 = 11
388 = 14
439 = 10
389i = 12
392 = 11
389ii = 28
458 = 15
459a = 8
459b = 9
455 = 8
454 = 11
447 = 23
437 = 16
448 = 20
449 = 28;29
DYS
464a = 12
464b = 14
464c = 15
464d = 15
460 = 10
GATA-H4 = 12
YCAIIa = 19
YCAIIb = 21
456 = 14
607 = 14
576 = —
570 = —
CDYa = —
CDYb = —
442 = 12
438 = 10
531 = 11
578 = 8
395S1a = 15
395S1b = 15
590 = 8
537 = 11
641 = 10
472 = 8
406S1 = 9
511 = —
425 = 12
413a = —
413b = —
557 = 15
594 = 10
436 = 12
490 = 12
534 = —
450 = 8
444 = 13
481 = —
520 = 20
446 = 13
617 = 13
568 = 11
487 = 12
572 = 11
640 = 11
492 = 12
565 = 11
461 = 12
462 = 13
GATA-A10 = 13
635/C4 = 21;22
B07 = 11
441 = 16
445 = 11
452 = 12
463 = 19

I1 Ultra-Norse Type 1 (I1-uN1) "Has its peak gradient in Norway."DYS
393 = 13
390 = 23
394 = 14
391 = 10
385a = 14
385b = 15
426 = 11
388 = 14
439 = 11
389i = 12
392 = 11
389ii = 28
458 = 15
459a = 8
459b = 9
455 = 8
454 = 11
447 = 23
437 = 16
448 = 20
449 = 28;29
DYS
464a = 12
464b = 14
464c = 15
464d = 16
460 = 10
GATA-H4 = 12
YCAIIa = 19
YCAIIb = 21
456 = 14
607 = 14
576 = —
570 = —
CDYa = —
CDYb = —
442 = 12
438 = 10
531 = 11
578 = 8
395S1a = 15
395S1b = 15
590 = 8
537 = 11
641 = 10
472 = 8
406S1 = 9
511 = 10
425 = 12
413a = 23
413b = 25
557 = 15
594 = 10
436 = 12
490 = 12
534 = 17;18
450 = 8
444 = 13
481 = 25;26
520 = 20
446 = 13
617 = 13
568 = 11
487 = 12
572 = 11
640 = 11
492 = 12
565 = 11
461 = 12
462 = 13
GATA-A10 = 13
635/C4 = 21
B07 = 11
441 = 16
445 = 11
452 = 12
463 = 19

Many other [http://dgmweb.net/genealogy/DNA/Hg-I-subclades-FTDNA-order.shtml Nordtvedt haplotypes] exist, and Nordtvedt has continually refined the haplogroup with more types as they become apparent from more I1 types being tested.

Famous

Alexander Hamilton, through genealogy and the testing of his descendants, has been placed within Y-DNA haplogroup I1. [ [http://isogg.org/ffdna.htm Founding Father DNA] & [http://www.personal.psu.edu/faculty/g/a/gah4/HamDNA/Results.html Hamilton DNA Project Results Discussion] ]

DYS
393 = 13
390 = 22
394 = 14;15
391 = 10
385a = 13
385b = 14
426 = 11
388 = 14
439 = 12
389i = 13
392 = 11
389ii = 29
458 = 15
459a = 8
459b = 9
455 = 8
454 = 11
447 = 22
437 = 16
448 = 20
449 = 31
DYS
464a = 12
464b = 14
464c = 15
464d = 15
460 = 10
GATA-H4 = 10
YCAIIa = 19
YCAIIb = 21
456 = 14
607 = 16
576 = 16
570 = 19
CDYa = 35
CDYb = 38
442 = 12
438 = 10

Mutations

The following are the technical specifications for known I1 haplogroup SNP and STR mutations.

Name: M253 [ [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?searchType=adhoc_search&type=rs&rs=rs9341296 M253] ] :Type: SNP:Source: M (Peter Underhill, Ph.D. of [http://hpgl.stanford.edu Stanford University] ):Position: [http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/?name=ChrY%3A13532101..13532101 ChrY:13532101..13532101 (+ strand)] :Position (base pair): 283:Total size (base pairs): 400:Length: 1:ISOGG HG: I1a:Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG:Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT:YCC HG: I1:Nucleotide alleles change (mutation): C to T

Name: M307 [ [http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=13447354 M307] ] :Type: SNP:Source: M (Peter Underhill, Ph.D. of Stanford University):Position: [http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/?name=ChrY%3A21160339..21160339 ChrY:21160339..21160339 (+ strand)] :Length: 1:ISOGG HG: I1a:Primer F: TTATTGGCATTTCAGGAAGTG:Primer R: GGGTGAGGCAGGAAAATAGC:YCC HG: I1:Nucleotide alleles change (mutation): G to A

Name: P30 [ [http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=P30;class=Sequence;ref=ChrY;start=13006761;end=13006761 P30] ] :Type: SNP:Source: PS ( [http://hammerlab.biosci.arizona.edu/michael_hammer.html Michael Hammer] , Ph.D. of the [http://hammerlab.biosci.arizona.edu/ University of Arizona] and [http://www.ethnoancestry.com/about.htm James F. Wilson] , D.Phil. at the University of Edinburgh):Position: [http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/?name=ChrY%3A13006761..13006761 ChrY:13006761..13006761 (+ strand)] :Length: 1:ISOGG HG: I1a:Primer F: GGTGGGCTGTTTGAAAAAGA:Primer R: AGCCAAATACCAGTCGTCAC:YCC HG: I1:Nucleotide alleles change (mutation): G to A:Region: ARSDP

Name: P40 [ [http://ymap.ftdna.com/cgi-bin/gbrowse_details/hs_chrY?name=P40;class=Sequence;ref=ChrY;start=12994402;end=12994402 P40] ] :Type: SNP:Source: PS (Michael Hammer, Ph.D. of the University of Arizona and James F. Wilson, D.Phil. at the University of Edinburgh):Position: [http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/?name=ChrY%3A12994402..12994402 ChrY:12994402..12994402 (+ strand)] :Length: 1:ISOGG HG: I1a:Primer F: GGAGAAAAGGTGAGAAACC:Primer R: GGACAAGGGGCAGATT:YCC HG: I1:Nucleotide alleles change (mutation): C to T:Region: ARSDP

Name: DYS455 [ [http://www.gdb.org/gdb-bin/genera/genera/hgd/GenomicSegment?!action=query&displayName=DYS455* DYS455] ] :Type: STR (repeat):Position: [http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/?name=ChrY%3A6971459..6971638 ChrY:6971459..6971638 (+ strand)] :Length: 180:Primer F: ATCTGAGCCGAGAGAATGATA:Primer R: GGGGTGGAAACGAGTGTT

Popular culture

In the book "Blood of the Isles", published in North America as "Saxons, Vikings & Celts: The Genetic Roots of Britain and Ireland", author Bryan Sykes gave the name of the Nordic deity Wodan to represent the clan patriarch of I1, as he did for mitochondrial haplogroups in a previous book, "The Seven Daughters of Eve". Every male identified as I1 is a descendant of this man.

Another writer, Stephen Oppenheimer, discussed I1 in his book "The Origins of the British". Although somewhat controversial, Oppenheimer, unlike Sykes, argued that Anglo-Saxons did not have much impact on the genetic makeup of the British Isles. Instead he theorized that the vast majority of British ancestry originated in a paleolithic Iberian people, traced to modern-day Basque populations, represented by the predominance of Haplogroup R1b in the United Kingdom today. [ [http://www.prospect-magazine.co.uk/article_details.php?id=7817 "Myths of British Ancestry," "Prospect" Magazine] ] A similar, more broad-based argument was made by Ellen Levy-Coffman in the [http://www.jogg.info "Journal of Genetic Genealogy"] . [ [http://www.jogg.info/22/Coffman.htm We Are Not Our Ancestors: Evidence for Discontinuity between Prehistoric and Modern Europeans] ] The book "When Scotland Was Jewish" is another example. These are direct challenges to previous studies led by Luigi Luca Cavalli-Sforza, Siiri Rootsi and others. [ [http://evolutsioon.ut.ee/publications/Rootsi2004.pdf Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow In Europe] ] Cavalli-Sforza has studied the connections between migration patterns and blood groups. There has been some discussion of this on a mailing list at RootsWeb. [ [http://archiver.rootsweb.com/th/read/y-dna-haplogroup-i/2007-01/1168077369 Blood groups and Haplogroup I] ]

Spencer Wells gave a brief description of I1 in the book "Deep Ancestry: Inside The Genographic Project".

References

ee also

*Haplogroup
*Human Y-chromosome DNA haplogroups
*Haplogroup I (Y-DNA)
*Haplogroup I2 (Y-DNA)
*Genetic history of Europe
*European ethnic groups
*Neolithic Europe
*
*Germanic peoples
* Norse Sagas
*History of Normandy
*Norse colonization of the Americas
*Ukrainian LGM refuge

Further reading

* [http://www.nature.com/ejhg/journal/v14/n8/pdf/5201651a.pdf Y-chromosome diversity in Sweden – A long-time perspective]
* [http://mbe.oxfordjournals.org/cgi/reprint/19/7/1008.pdf Y chromosome evidence for Anglo-Saxon mass migration]
* [http://download.current-biology.com/pdfs/0960-9822/PIIS0960982203003737.pdf A Y Chromosome Census of the British Isles]
* [http://www.jogg.info/12/Athey.pdf Resolving the Placement of Haplogroup I-M223 in the YChromosome Phylogenetic Tree]
*Oppenheimer, Stephen "The Origins of the British: A Genetic Detective Story" (Carroll & Graf, 2006) ISBN 978-0786718900
*Sykes, Bryan "Saxons, Vikings, and Celts: The Genetic Roots of Britain and Ireland" (W. W. Norton, 2006) ISBN 978-0393062687

External links

* [http://members.bex.net/jtcullen515/haplotest.htm Haplo-I Subclade Predictor]
* [http://knordtvedt.home.bresnan.net Y-chromosome research by Ken Nordtvedt]
* [http://dgmweb.net/genealogy/DNA/Hg-I-subclades-FTDNA-order.shtml Nordvedt's Haplogroup I1 Varieties with STR Markers in FTDNA Order]
* [http://ymap.ftdna.com/cgi-bin/gbrowse/hs_chrY/ FTDNA's Y Chromosome Browser]
* [http://entertainment.timesonline.co.uk/tol/arts_and_entertainment/books/article533227.ece Review of "The Tribes of Britain"]
* [http://www.gnxp.com/blog/2008/03/origins-of-british.php Blog on "The Origins of the British"]
* [http://www.smgf.org/resources/papers/PosterASHG2003.pdf Large Scale DNA Variation as an Aid to Reconstruction of Extended Human Pedigrees, Scandinavian and German Y haplotypes]
* [http://blog.eogn.com/eastmans_online_genealogy/2006/10/saxons_vikings_.html Discussion of "Saxons, Vikings, and Celts: The Genetic Roots of Britain and Ireland"]
* [http://www.ethnoancestry.com/I1a Testing for the S-series of SNPs within I1 (Called I1a)]
* [http://www.personal.psu.edu/faculty/g/a/gah4/MsDNA/I1a.html Distribution of Repeat Values at Various STR Sites for Haplogroup I1 (Called I1a)]
* [http://www.familytreedna.com/forum/forumdisplay.php?s=&forumid=90 I1 discussion forum at FTDNA]
* [http://www.jogg.info/31/campbell.htm Analysis of Sykes' Data and Conclusions]
* [http://www.jogg.info/32/campbell.htm Analysis of Oppenheimer's Data and Conclusions]
* [http://freepages.genealogy.rootsweb.com/~gallgaedhil/haplo_i1a_part_1.htm I1 DYS frequencies according to Geographical Locale (Called I1a)]
* [http://dienekes.blogspot.com/2005/01/western-norwegian-modal-haplotype.html Dienekes Anthropology page; I1 as modal haplotype of Western Norway (Called I1a)]
* [http://lists.rootsweb.com/index/other/DNA/Y-DNA-HAPLOGROUP-I.html Mailing List for Haplogroup I]
* [http://isogg.org/tree/ISOGG_HapgrpI07.html Haplogroup I and Its Subclades]
* [http://www.newadvent.org/cathen/11115b.htm Northmen (Vikings) Description in The Catholic Encyclopedia]
* [http://www.1911encyclopedia.org/Viking Viking Description in the Encyclopaedia Britannica]
* [http://pages.globetrotter.net/peter_frost61z/European-hair-and-eye-color.htm Why Do Europeans Have So Many Hair and Eye Colors?]
* [http://www.smgf.org Sorenson Molecular Genealogy Foundation]
* [http://www.ysearch.org ySearch]
* [http://www.ybase.org Ybase]

Maps

* [http://www.relativegenetics.com/genomics/images/haploMaps/originals/I1a_large_RG.jpgMap of I1 (Called I1a)]

Projects

* [http://www.familytreedna.com/public/yDNA_I1 I1 Project at FTDNA]
* [http://dgmweb.net/genealogy/DNA/DK/DanishDemes-YDNA-results-HgI1a.shtml Danish Demes Regional DNA Project: Y-DNA Haplogroup I1 (Called I1a)]


Wikimedia Foundation. 2010.

Look at other dictionaries:

  • Haplogroup I (Y-DNA) — Infobox haplogroup name =I origin date =20,000 25,000 years BP origin place =Western Balkans / former Adriatic steppes, Central and Western Europe / Germany, Western Scandinavia / Sweden and Norway ancestor =IJ descendants =I1, I2 mutations =M170 …   Wikipedia

  • Haplogroup G2c (Y-DNA) — In human genetics, Haplogroup G2c (formerly G5) is a Y chromosome haplogroup and is defined by the presence of the M377 mutation.cite journal author=Sengupta S, Zhivotovsky LA, King R, et al title=Polarity and temporality of high resolution y… …   Wikipedia

  • Haplogroup E1b1b (Y-DNA) — Infobox haplogroup name = E1b1b or E M215 origin place = East Africa or Middle East [https://www3.nationalgeographic.com/genographic/atlas.html National Geographic s Genographic Project Haplogroup E3b (M35)] ] origin date = approx 26,000 years BP …   Wikipedia

  • Haplogroup I2 (Y-DNA) — Infobox haplogroup name =I2 origin date =probably >15 kya (see subclade descriptions) origin place =Southeastern Europe ancestor = I descendants =I2a, I2b (see subclade descriptions) mutations =M438/P215/S31 members =I2a1 Croatia, Bosnia and… …   Wikipedia

  • Haplogroup IJ (Y-DNA) — Infobox haplogroup name =IJ origin date = origin place =Middle East ancestor =F descendants =I, J mutations =M429, P123, P124, P125, P126, P127, P129, P130, S2, S22In human genetics, Haplogroup IJ is a human Y chromosome DNA haplogroup.Haplogroup …   Wikipedia

  • Haplogroup G (Y-DNA) — Infobox haplogroup name =G origin date = 40,000 BCE origin place =Near East or Southern Asia ancestor =F brother groups = haplogroups H, IJ (parent of I and J), and K descendants =G1 (M285), G2a (P15), G2c (M377), G3 (P287) mutations =M201… …   Wikipedia

  • Haplogroup O (Y-DNA) — In human genetics, Haplogroup O (M175) is a Y chromosome DNA haplogroup.DistributionThis haplogroup appears in 80 90% of all men in East and Southeast Asia, and it is almost exclusive to that region: M175 is almost nonexistent in Western Siberia …   Wikipedia

  • Haplogroup R1a (Y-DNA) — Infobox haplogroup name =R1a origin date =15,000 years BP origin place =East Iran or Pakistan or North India or Western Caucasus or Ukraine ancestor =Haplogroup R1 descendants = mutations =SRY 1532, M17 members =Ishkashimi 68%, Tajik/Khojant 64% …   Wikipedia

  • Haplogroup D (Y-DNA) — Infobox haplogroup name =D origin date =approx. 50,000 BP [http://www.isogg.org/tree/ISOGG HapgrpD08.html Y DNA Haplogroup D and its Subclades 2008] ] origin place =AsiaKarafet et al. (2008), [http://www.genome.org/cgi/content/abstract/gr.7172008v… …   Wikipedia

  • Haplogroup F (Y-DNA) — Infobox haplogroup name =F origin date =45,000 years BP origin place =North Africa, Middle East or South Asia ancestor =CF descendants =G, H, IJ, K mutations =M89, M213/P137, M235, P14, P133, P134, P135, P136, P138, P139, P140, P141, P142, P145,… …   Wikipedia


Share the article and excerpts

Direct link
Do a right-click on the link above
and select “Copy Link”

We are using cookies for the best presentation of our site. Continuing to use this site, you agree with this.